GENETIC DIVERSITY OF ENTEROCOCCUS FAECALIS ISOLATES FROM CHILDREN WITH URINARY TRACT INFECTION IN PRIMORSKY KRAI OF RUSSIA



Cite item

Abstract

Background: Escherichia coli is the most common cause of urinary tract infections (UTI). However, Enterococcus faecalis has been shown to be the most common causative agent of UTI among children and newborns in Primorsky Krai of Russia warranting further research. Aim: To study the occurrence of pathogenicity factor genes in the E. faecalis isolates from children with UTI in the Primorsky Krai of the Russian Far East. Methods: Forty-two E. faecalis clinical isolates from children under the age of 16 with UTI identified in 2013-2017 were studied. Phylogenetic diversity of the strains was assessed by the ultilocus sequence typing. Six genes, namely, cylA, aggA, efaA, eep, gelE, esp were tested in the isolates by polymerase chain reaction . Results: CylA, aggA, efaA, eep, gelE and esp genes occurred in 50.0 %, 80.95 %, 100 %, 100 %, 76.2 % and 71.4 % of the isolates, respectively. Eleven different gene variants were detected for the combination of pathogenicity factor genes. The most common gene variants were (aggA, cylA, efaA, eep, gelE, esp) and (aggA, efaA, eep, gelE). Among the uropathogenic E. faecalis. Fourteen sequence-types were identified (ST6, ST16, ST21, ST25, ST40, ST41, ST64, ST116, ST133, ST151, ST179, ST480, ST537, ST774), with ST179, ST774, ST6 being the most common. Conclusions: The identified diversity of sequence-types indicates the genetic heterogeneity of uropathogenic enterococci isolated in the Primorsky Krai. The detection of a large amount of pathogenicity factors and their combinations causes the predominance of E. faecalis in the region as a clinically relevant etiological agent of UTI among children. The identification of highly virulent sequence types such as E. faecalis ST6, ST179 and ST774 warrants further research to determine the population structure of enterococci.

Full Text

Введение Энтерококки составляют неотъемлемую часть кишечной микрофлоры многих беспозвоночных, птиц и млекопитающих, включая человека [27]. Роль энтерококков заключается в поддержании микробного гомеостаза, стимуляции иммунной модуляции и предотвращении развития инфекций патогенными бактериями и вирусами [4]. С другой стороны, энтерококки, в частности Enterococcus faecalis, все чаще занимают лидирующую позицию в этиологии различных заболеваний, в том числе инфекций мочевыводящих путей (ИМП) [1-3]. Так, в Приморском крае, по данным Краевой детской клинической больницы № 1 (Владивосток) за 2007-2015 годы, в отделении новорожденных E. faecalis имел первостепенное значение в развитии ИМП, выявляясь в диапазоне от 30,8 до 74,5 % случаев, с тенденцией роста в 2015 году [3]. Рост заболеваемости энтерококковыми инфекциями связывают с различными факторами патогенности, в том числе с генами вирулентности, которые могут инициировать инфекционный процесс [11]. Цитолизин (Cyl) - токсин белковой природы, обладающий цитолитической (в отношении прокариотических и эукариотических клеток), гемолитической и бактерицидной активностью [4]. Многочисленные исследования доказали наличие связи между экспрессией цитолизина и повышенной тяжестью инфекции, вызванной E. faecalis [9, 10]. Группа гидролитических ферментов, включающая гиалуронидазу (Hyl), желатиназу (GelE) и сериновую протеазу (SprE), также увеличивает вирулентность энтерококков. Данные протеазы участвуют в инвазии и транслокации E. faecalis, а также в распространении их токсинов через ткань хозяина [16]. Поверхностно-опосредованная белковая адгезия к тканям хозяина приводит к энтерококковой колонизации и последующему образованию биопленки, воспалению и развитию инфекции. Примерами поверхностно-экспонированных маркеров вирулентности E. faecalis являются капсульные полисахариды, гликолипиды, коллаген-связывающий белок (Ace), пили, ассоциированные с развитием эндокардита и биопленки (Ebp), агрегационные вещества (AS, Agg) и др. [18, 10, 29]. Известно, что энтерококковый поверхностный белок (Esp) участвует в клеточной адгезии, колонизации и персистенции в мочевых путях, уклонении от иммунной системы [18]. Белок агрегации (Agg) обеспечивает адгезию E. faecalis к различным клеткам хозяина, в том числе клеткам почечных канальцев и энтероцитов [10]. Энтерококки известны своей способностью обмениваться генетической информацией посредством горизонтального переноса генов, благодаря чему может происходить усиление их вирулентности [11]. Кроме того, предполагается, что горизонтальный перенос генов играет ключевую роль в формировании энтеро-кокковых геномов, бактериальной функциональности и филогении E. faecalis [9]. Структура популяции E. faecalis включает в себя множество сиквенс-типов (ST) и клональных комплексов (CC). Клональные комплексы CC2, CC9, CC16, CC30, CC40 и CC87 относятся к СС высокого риска, поскольку они в основном включают в себя изоляты, вызывающие инфекцию у госпитализированных пациентов, а также участвуют в распространении устойчивости к противомикробным препаратам [7, 14]. Однако данных о генетическом разнообразии популяции уропатогенных энтерококков на территории России недостаточно для понимания целостной картины их вклада в этиопатогенез ИМП. Таким образом, очевидна необходимость проведения глубоких исследований популяции E. faecalis с помощью современных методов. Целью данной работы являлось генотипирование и тестирование наличия генов факторов патогенности у изолятов Enterococcus faecalis, выделенных у детей при инфекциях мочевыводящих путей в Приморском крае Дальневосточного региона России. Методы Исследование было одобрено Междисциплинарным комитетом по этике Тихоокеанского государственного медицинского университета (Протокол № 4 от 26 декабря 2016 г. и Протокол № 3 от 20 ноября 2017 г.). Информированное согласие на участие в исследовании было получено от родителей детей или их законных опекунов. Изоляты E. faecalis (n = 42) были выделены в период с 2013 по 2017 год в краевой детской клинической больнице № 1 г. Владивостока из мочи у детей в возрасте от трех дней до шестнадцати лет с инфекциями мочевыводящих путей. Штаммы уропа-тогенных фекальных энтерококков были охарактеризованы нами ранее с помощью микробиологических методов [2]. Бактериальную ДНК у E. faecalis (n = 42) выделяли с помощью набора «ДНК-экспресс» (Литех, Москва). Тестирование генов факторов патогенности энтерококков (n = 42) проводили с помощью полимеразной цепной реакции (ПЦР), применяя ранее разработанные наборы праймеров (табл. 1), синтезированные Таблица 1 Праймеры для тестирования генов факторов патогенности E. faecalis и параметры полимеразной цепной реакции Ген; размер продукта (bp) Последовательность ДНК Темпе ратура отжига Ссыл ка cylA; 517 T GGAT GATAGT GATAGGAAGT T CTACAGTAAAT CTTT CGT CA 57 ’С [5] aggA; 1553 AAGAAAAAGTAGACCAAC AACGGCAAGACAAGTAAATA 52 ’С [5] efaA; 705 GACAGACCCT CACGAATA AGTT CAT CATGCTGCT GTAGTA 52 ’С [5] eep; 937 GAGCGGGTATTTTAGTT CGT TACT CCAGCATT GGATGCT 58 ’С [5] esp; 933 TT GCTAAT GCTAGT CCACGACC GCGTCAACACTTGCATTGCCGAA 62 ’С [5] gelE; 419 ACCCCGTATCATTGGTTT ACGCATTGCTTTTCCATC 56 ’С [22] 50 Ekologiya cheloveka (Human Ecology) 2021, 12, pp. 49-55 Original Articles компанией «Евроген» (Москва). проводили ПЦР в соответствии с рекомендованными параметрами на амплификаторе Mastercycler proS (Eppendorf). Скорость нагрева и охлаждения проб была уменьшена до 50 %. Продукты амплификации анализировали в 1 % агарозном геле, содержащем 1 мкг/мл бромистого этидия, в ультрафиолетовом свете с помощью гель-документирующей системы E-Box VX5/20M. Для генотипирования изолятов использовали метод мультилокусного типирования (MLST) [19]. ПЦР-амплификацию локусов проводили в соответствии с рекомендациями, опубликованными на сайте базы данных http://efaecalis.mlst.net/misc/info.asp. Продукты ПЦР очищали методом электрофореза в агарозном геле и с помощью набора «Cleanup mini» (Евроген, Москва). Построение филогенетических дендрограмм проводили с помощью cервиса Interactive Tree of Life (iTOL) [12]. Полученные нуклеотидные последовательности были депонированы в международную базу данных «Enterococcus faecalis MLST Databases» (https://pubmlst.org/efaecalis/). Результаты Описанная коллекция E. faecalis была проанализирована с помощью ПЦР на присутствие генов, кодирующих факторы патогенности (aggA, esp, efaA, eep, cylA, gelE). Все изоляты энтерококков содержали более двух из шести тестируемых генов факторов патогенности. У одного изолята (2,4 %) выявили два гена, кодирующих факторы патогенности, у трех (7,2 %) - три гена, у четырнадцати (33,3 %) - четыре гена, у десяти (23,8 %) - пять генов факторов патогенности и еще у четырнадцати (33,3 %) изолятов - все тестируемые гены исследуемых факторов патогенности (табл. 2). Среди исследуемых культур E. faecalis частота встречаемости генов cylA (цитолизин), aggA (вещество агрегации), efaA (белок, связанный с адгезией), Таблица 2 Комбинация генов факторов патогенности, у уропатогенных E. faecalis, выделенных из мочи от детей с инфекцией мочевых путей Номер геноварианта Комбинация генов факторов патогенности Сиквенс-тип (Частота встречаемости, n) 1 aggA, cylA, efaA, eep, gelE, esp ST25 (1); ST116 (1); ST179 (11); ST537 (1) 2 aggA, cylA, efaA, eep, gelE ST179 (1); ST64 (1) 3 aggA, efaA, eep, gelE ST774 (2); ST6 (5) 4 efaA, eep, gelE, esp ST40 (2); ST151 (1) 5 aggA, cylA, efaA, eep ST16 (1); ST133 (1) 6 aggA, efaA, eep, gelE, esp ST41 (1); ST25 (1); ST774 (3) 7 aggA, cylA, efaA, eep, esp ST16 (2) 8 aggA, efaA, eep, esp ST774 (1); ST480 (1) 9 efaA, eep ST21 (1) 10 cylA, efaA, eep, gelE, esp ST179 (1) 11 efaA, eep, esp ST21 (3) Таблица 3 Идентификация генов, кодирующих факторы патогенности у уропатогенных E. faecalis, выделенных от детей с инфекцией мочевых путей Номер штамма id Год изоляции Ген факторов патогенности Сик венс-тип 1» йд & ДО efaA & 0Д Об щее чис ло PRV054 1780 2013 + - + + + 4 ST6 PRN030 1779 2015 + - + + + 4 ST6 PRN033 1926 2015 + - - + + + 4 ST6 PR198 2099 2016 + - - + + + 4 ST6 PRV158 1936 2016 + - - + + + 4 ST6 PR050 1781 2013 + + + + + - 5 ST16 PR212 1945 2016 + + + + + - 5 ST16 PRV092 1782 2016 + - + + + - 4 ST16 PRV082 1783 2016 - - - + + - 2 ST21 PRV044 1927 2013 - + - + + - 3 ST21 PRN095 1928 2016 - + - + + - 3 ST21 PRV118 1931 2016 - + - + + - 3 ST21 PRU35 1939 2015 + + - + + + 5 ST25 PR048 1933 2013 + + + + + + 6 ST25 PRA038 1785 2013 - + - + + + 4 ST40 PR055 1784 2013 - + - + + + 4 ST40 PRV049 1786 2013 + + - + + + 5 ST41 PRV102 1929 2016 + - + + + + 5 ST64 PR042 1787 2013 + + + + + + 6 ST116 PR293 1943 2017 + - + + + - 4 ST133 PR036 1938 2015 - + - + + + 4 ST151 PRU047 1788 2013 + - + + + + 5 ST179 PR043 1940 2013 - + + + + + 5 ST179 PRV052 1789 2013 + + + + + + 6 ST179 PRV100 1791 2016 + + + + + + 6 ST179 PRV105 1790 2016 + + + + + + 6 ST179 PRV103 1930 2016 + + + + + + 6 ST179 PRV086 1941 2016 + + + + + + 6 ST179 PR 278 1942 2017 + + + + + + 6 ST179 PR 370 1944 2017 + + + + + + 6 ST179 PR233 1946 2016 + + + + + + 6 ST179 PR243 1947 2017 + + + + + + 6 ST179 PR247 1948 2017 + + + + + + 6 ST179 PR251 1949 2017 + + + + + + 6 ST179 PR215 1937 2016 + + - + + - 4 ST480 PR230 1932 2016 + + + + + + 6 ST537 PR051 1792 2013 + - - + + + 4 ST774 PRA029 1795 2015 + - - + + + 4 ST774 PR040 1794 2013 + + - + + - 4 ST774 PRAs081 1793 2016 + + - + + + 5 ST774 PRL079 1934 2016 + + - + + + 5 ST774 PRV080 1935 2016 + + - + + + 5 ST774 Примечание. id - международный идентификационный номер, присвоенный штамму E. faecalis, в международной базе данных «Enterococcus faecalis MLST Databases» (https://pubmlst.org/ efaecalis/) 51 Оригинальные статьи Экология человека 2021, № 12, с. 49-55 eep (усилитель экспрессии феромона), gelE (жела-тиназа) и esp (поверхностный белок) составляла 50,0, 80,95, 100, 100, 76,2 и 71,4 % соответственно. Стоит отметить, что два гена, кодирующих факторы патогенности - efaA и eep, выявлялись у всех исследуемых уропатогенных E. faecalis. Эти данные свидетельствуют в пользу того, что продукты генов efaA и eep необходимы E. faecalis при взаимодействии с эукариотическим организмом на определенных этапах инфекционного процесса. Известно, что количество детектируемых генов факторов патогенности коррелирует с вирулентностью штаммов [8]. Частота встречаемости генов факторов патогенности у дальневосточных клинических изолятов, выделенных из мочи у детей, выше, чем в коллекциях клинических изолятов E. faecalis, выделенных из мочи, описанных другими исследователями. Так, например, гены efaA, eep, aggA, cylA, gelE встречались в 3 раза чаще, чем в коллекции из Кувейта [26], и в 2 раза чаще, чем в бразильских изолятах [5]. Для генов gelE, esp, efaA, eep частота детекции была в 1,5 раза выше, чем для изолятов, описанных в Чили [17]. Интересно, что частота встречаемости генов cylA, esp и gelE была сопоставима с частотой встречаемости, описанной для штаммов энтерококков, выделенных в Okayama University Hospital (Япония) [21]. Результаты ПЦР-анализа выявили одиннадцать вариантов сочетания генов, кодирующих факторы патогенности у штаммов E. faecalis, выделенных из мочи у детей (табл. 3). Из приведенных данных видно, что самыми распространенными геновариантами являются первый (aggA, cylA, efaA, eep, gelE, esp) (n = 14; 33,3 %) и третий (aggA, efaA, eep, gelE) (n = 7; 16,7 %). По результатам мультилокусного типирования 42 протестированных E. faecalis принадлежали к четырнадцати (ST6, ST16, ST21, ST25, ST40, ST41, ST64, ST116, ST133, ST151, ST179, ST480, ST537, ST774) сиквенс-типам (рисунок). Среди E. Faecalis, выделенных из мочи детей в Приморском крае, наиболее часто выявлялся ST179, который включал тринадцать штаммов. Реже встречались ST774 (n = 6), ST6 (n = 5), ST21 (n = 4), ST16 (n = 3), ST25 (n = 2) и ST40 (n = 2). Для ST41, ST64, ST116, ST133, ST151, ST480, ST537 было идентифицировано по одному штамму. Штаммы E. faecalis внутри некоторых сиквенс-типов (ST16, ST21, ST25, ST179 и ST774) демонстрировали различные комбинации изучаемых генов факторов патогенности (см. табл. 2, 3). E. faecalis ST16 сиквенс-типа имели два различных геноварианта: (aggA, cylA, efaA, eep, esp) (n = 2) и (aggA, cylA, efaA, eep) (n = 1). Энтерококки ST21 характеризовались минимальным набором генов патогенности, штаммы данного сиквенс-типа несли два (efaA, eep) (n = 1) или три (efaA, eep, esp) (n = 3) исследуемых гена. Для ST25 отмечено два варианта комбинации генов патогенности: 1) с максимальным числом исследуемых генов - первый геновариант (n = 1); и 2) шестой геновариант, отличающийся от первого варианта отсутствием cylA гена (n = 1) (см. табл. 2, 3). Сиквенс-типу ST179 соответствовало тринадцать E. faecalis с тремя разными (первым, вторым и десятым) генотипами. Штаммы ST179 содержали максимальное количество исследованных генов факторов патогенности (первый геновариант (n = 11)), за исключением E. faecalis PRV047, в котором отсутствовал ген esp (второй геновариант) и E. faecalis PR043, в котором отсутствовал aggA ген (десятый геновариант) (см. табл. 2, 3). К сиквенс-типу ST774 относилось шесть штаммов E. faecalis с тремя (третий (n = 2), шестой (n = 3) и восьмой (n = 1)) генотипами. E. faecalis PRL079, E. faecalis PRV080 и E. faecalis PRAs081 обладали наибольшим количеством (пятью из шести) генов факторов патогенности (6 геновариант). Генотипы штаммов E. faecalis PRA029 и E. faecalis PR051 (3 геновариант), в отличие от 6 геноварианта не обладали геном esp. Штамм E. faecalis PR040 содержал Дендрограмма, отображающая филогенетическое сходство штаммов E. faecalis, изолированных в Приморском крае 52 Ekologiya cheloveka (Human Ecology) 2021, 12, pp. 49-55 Original Articles ген esp, однако был ПЦР-негативен по гену, кодирующему желатиназу (8 геновариант) (см. табл. 2, 3). Обсуждение Характеристика 42 штаммов E. faecalis, выделенных из мочи детей в Приморском крае с использованием MLST, является первой попыткой описания генетической структуры популяции этого вида в России. Полученные результаты были сопоставлены с базой данных MLST [12], содержащей данные о более чем 2 200 штаммах E. faecalis. Среди штаммов E. faecalis, выявленных в Приморском крае, были идентифицированы наиболее распространённые в мире сиквенс-типы - ST6 (113 (5,7 %) загрузок в базу данных), ST16 (65 (3,3 %) загрузок в базу данных), ST21 (69 (3,5 %) загрузок в базу данных) и ST40 (60 (3,0 %) загрузок в базу данных)) [12]. Так, ST6 был обнаружен в 12 странах мира: Испании, США, Португалии, Польше, Норвегии, Кубе, Нидерландах, Франции, Нигерии, Японии, Испании, Малайзии [12]. Штаммы E. faecalis ST6 заслуживают особого внимания, поскольку данный сиквенс-тип обычно встречается среди нозокомиальных изолятов и представляет собой адаптировавшийся к госпитальной среде клональный комплекс СС2 [19, 28]. Однако в Нигерии ST6 был выделен из фекалий животных (свиней) [12], а в Норвегии из фекалий здорового младенца [23]. По данным литературы известно, что E. faecalis CC2 обладают чувствительностью к ванкомицину, редко несут ген поверхностного белка энтерококка (esp), но проявляют высокую устойчивость к аминогликозидам [15]. Все исследованные нами штаммы E. faecalis ST6, выделенные в Приморском крае, не несли ген esp, были чувствительны к ванкомицину, но устойчивы к аминогликозидам (данные не показаны). В исследовании Kawalec M. с соавт. среди клинических изолятов E. faecalis, выделенных в Польше, сиквенс-тип ST40 являлся наиболее частым [13]. Ранее ST40 не относился к адаптированным клиническим изолятам, так как был обнаружен только у трех штаммов энтерококков, выделенных от животного в Нидерландах, от госпитализированного пациента и от здорового добровольца из Испании [12]. Это позволило авторам предположить, что адаптированный клинический ST40 возник в Польше или соседних странах [13]. На сегодняшний день циркуляция данного сиквенс-типа наблюдается по всей Европе [12, 24]. В других странах (Куба, Бразилия, Нигерия, США) ST40 выделяется спорадически и, возможно, является результатом завоза [12]. Интересно, что в граничащем с Приморским краем Китае данный сиквенс-тип также был выявлен у энтерококков, изолированных при ИМП [29]. В недавнем исследовании коллекции E. faecalis ST40 было обнаружено, что гены gelE, fsrB и cps несли все штаммы энтерококков данного сиквенс-типа, а для asc-10, cylM и esp частота детекции варьировала от 16,7 до 78,6 %. Кроме того, не было обнаружено каких-либо расхождений между присутствием отдельных маркеров (gelE и cylM) и их экспрессией [30]. Приморские штаммы E. faecalis ST40 (id 1784; 1785) не несли cylA, и один штамм обладал желатиназо-негативным фенотипом в присутствии гена gelE. Однако из-за малого количества изолятов ST40 (n = 2) в данном исследовании очень трудно делать однозначные выводы о геномной изменчивости энтерококков внутри данного сиквенс-типа при распространении на другие территории. Считается, что ST21 не имеет особого значения для больничной среды, так как часто обнаруживается у энтерококков, изолированных из еды, окружающей среды и от животных [12, 14]. Выявление штаммов E. faecalis ST21 среди госпитализированных пациентов предполагает, что они обладают свойствами, способствующими колонизации тканей человека [7]. Так, в исследовании Kuch A. с соавт. около 30 % клинических штаммов энтерококков ST21 сиквенс-типа обладали множественной лекарственной устойчивостью (МЛУ), которая обычно обнаруживалась среди основных эпидемических штаммов [14], а в Польше данный сиквенс-тип включал три изолята ванкомицин-резистентных энтерококков [13]. Штаммы E. faecalis ST21 сиквенс-типа, выделенные на территории Приморского края, не обладали МЛУ, были чувствительны к ванкомицину (данные не показаны) и характеризовались минимальным набором изучаемых генов патогенности, что может указывать на роль других генов в инициации ИМП либо на снижение резистентности макроорганизма, благодаря чему авирулентный штамм оказался способным вызвать инфекционный процесс. На основе кластерного анализа сиквенс-типы ST179, ST16 и ST537 объединены в клональный комплекс СС16. Считается, что энтерококки, относящиеся к CC16, хорошо адаптированы к условиям больничной среды, способны приобретать экзогенные гены посредством рекомбинации и могут нести детерминанты устойчивости к ванкомицину (vanA или vanB), а также конъюгативные плазмиды и транс-позоны, участвующие в передаче генов устойчивости к антибактериальным препаратам и вирулентности [6]. В Приморском крае СС16 оказался наиболее распространенным клональным комплексом, на который приходилось 40,5 % изучаемых E. faecalis. Интересно, что сиквенс-типы, входящие в СС16, чаще распространены в азиатских странах (Китай [29], Корея [12], Япония [25], Малайзия [28], Саудовская Аравия [6]) и реже выявляются в Америке [12, 20] и странах Европы [12]. Несмотря на близкое филогенетическое расположение, штаммы энтерококков ST16, ST179 и ST537, выделенные в Приморском крае, относились к разным геновариантам - 1, 2, 5, 7 и 10 (см. табл. 2). Генетическая вариабельность среди сиквенс-типов СС16 также была обнаружена другими учеными. Так, в Китае среди изолятов энтерококков, выделенных из мочи, ген aggA чаще детектировался у ST16, а присутствие gelE было ассоциировано с ST179 [29]. 53 Оригинальные статьи Экология человека 2021, № 12, с. 49-55 Обращает на себя внимание ST774 (n = 6), который часто встречался в Приморском крае. В настоящее время в мире зафиксирован только один случай выявления E. faecalis ST774 от госпитализированного пациента в Венгрии [12]. В нашем исследовании уро-патогенные штаммы E. faecalis ST774 сиквенс-типа содержали от 4 до 5 генов факторов патогенности. При этом штамм E. faecalis PRAs081 был выделен из мочи от пациента с летальным исходом. Среди E. faecalis, выделенных на территории Приморского края, 38 из 42 содержали четыре гена и более, кодирующих факторы патогенности, что намного выше описанных другими группами исследователей [5, 17, 26]. Наличие различных комбинаций генов вирулентности подтверждает, что уропатогенность энтерококков - это полидетерминированная характеристика, зависящая от множества, а не отдельных факторов [1]. Развитие инфекционного процесса требует взаимодействия разнообразных генов, ответственных за секрецию и регуляцию экспрессии факторов вирулентности [26]. По-видимому, наличие большого числа генов патогенности и их комбинаций способствует селекции высокопатогенных штаммов энтерококков, что дает им преимущество при развитии инфекционного процесса и делает E. faecalis одним из преобладающих уропатогенов в Приморском крае. Известно, что E. faecalis заселяют кишечник большинства видов теплокровных животных и способны выживать при попадании в почву или водоемы [9]. На распространение и циркуляцию E. faecalis также влияет их способность заселять пищеварительный тракт птиц [9]. Филогенетическое разнообразие энтерококков, охарактеризованных в данной работе, не выявило наличия на территории Приморского края единого «сверхпатогенного» штамма E. faecalis, однако может указывать на наличие неблагоприятной экологической обстановки, способствующей сохранению и циркуляции штаммов E. faecalis, обладающих большим набором факторов патогенности и способных вызывать ИМП. Выявленное разнообразие (как редко, так и широко встречаемых в мире) сиквенс-типов указывает на генетическую неоднородность энтерококков, выделенных в Приморском крае. Возможно, близость стран Азиатско-Тихоокеанского региона и большой туристический проход способствуют формированию региональных особенностей в распространении сиквенс-типов среди мочевых изолятов энтерококков и селекции высоковирулентных штаммов E. faecalis. Таким образом, полученные результаты показывают штаммоспецифический полиморфизм спектра генов, кодирующих факторы адгезии и инвазии у уропатогенных E. faecalis, выделенных у детей в Приморском крае. Заключение Мультилокусное типирование 42 штаммов E. faecalis, выделенных в Приморском крае, впервые представило данные о генетической структуре популяции этого вида в России. Высокая генетическая вариабельность среди уропатогенных штаммов энтерококков в данном исследовании дает некоторую информацию о локальном распространении, генетическом родстве и вирулентном потенциале E. faecalis на юге Дальнего Востока. Выявление высоковирулентных сиквенс-типов, таких как E. faecalis ST6, ST179 и ST774, подчеркивает важность определения структуры популяции энтерококков в различных географических районах для понимания влияния социально-демографических факторов на клональное разнообразие энтерококков и, следовательно, на возникновение и передачу вирулентных свойств. Суммируя полученные результаты, можно заключить, что для детального понимания этиопатогенеза инфекций мочевыводящих путей необходимо дальнейшее, более обширное исследование популяции E. faecalis в Приморском крае и других регионах России.
×

About the authors

T. S. Komenkova

Pacific State Medical University

Vladivostok

E. A. Zaitseva

Pacific State Medical University

Email: elza200707@mail.ru
Vladivostok

A. M. Shadrin

Pushchino Scientific Center for Biological Research of the Russian Academy of Scenes

Pushchino, Russia

References

  1. Вялкова А. А., Гриценко В. А., Гордиенко Л. М. Инфекция мочевой системы у детей - новые решения старой проблемы // Нефрология. 2010. Т. 14. № 4. С. 63-76
  2. Зайцева Е. А., Крукович Е. В., Мельникова Е. А., Лучанинова В. Н., Коменкова Т. С., Вайсеро Н. С. Роль факторов патогенности Enterococcus faecalis в развитии пиелонефрита у детей // Тихоокеанский медицинский журнал. 2017. № 2 (68). С. 58-60
  3. Мельникова Е. А., Зайцева Е. А., Лучанинова В. Н., Крукович Е. В., Коменкова Т. С., Феоктистова Ю. В. Дифференцированные подходы к лечению инфекции мочевой системы у детей с учетом этиологического фактора Enterococcus faecalis // Тихоокеанский медицинский журнал. 2019. № 4 (78). С. 60-65
  4. Ben Braiek O., Smaoui S. Enterococci: Between Emerging Pathogens and Potential Probiotics. Biomed Res Int. 2019, 2019, pp. 1-13.
  5. Bittencourt E. M., Suzart S. Occurrence of virulence-associated genes in clinical Enterococcus faecalis strains isolated in Londrina, Brazil. Journal of Medical Microbiology. 2004, 53, pp. 1069-1073.
  6. Farman M., Yasir M., Al-Hindi R. R., et al. Genomic analysis of multidrug-resistant clinical Enterococcus faecalis isolates for antimicrobial resistance genes and virulence factors from the western region of Saudi Arabia. Antimicrob Resist Infect Control. 2019, 8 (55), pp. 1-11.
  7. Freitas A. R., Novais C., Ruiz-Garbajosa P., Coque T. M., Peixe L. Clonal expansion within clonal complex 2 and spread of vancomycin-resistant plasmids among different genetic lineages of Enterococcus faecalis from Portugal. J Antimicrob Chemother. 2009, 63 (6), pp. 1104-1111.
  8. Freitas A. R., Tedim A. P., Novais C., Lanza V. F., Peixe L. Comparative genomics of global optrA-carrying Enterococcus faecalis uncovers a common chromosomal hotspot for optrA acquisition within a diversity of core and accessory genomes. Microb Genom. 2020, 6 (6), pp. 1-17.
  9. Gilmore M. S., Clewell D. B., Ike Y., Shankar N. Enterococci: from commensals to leading causes of drug resistant infection. Massachusetts Eye and Ear Infirmary. Boston: Massachusetts Eye and Ear Infirmary, 2014.
  10. Hällgren A., Claesson C., Saeedi B., Monstein H. J., Hanberger H., Nilsson L. E. Molecular detection of aggregation substance, enterococcal surface protein, and cytolysin genes and in vitro adhesion to urinary catheters of Enterococcus faecalis and E. faecium of clinical origin. Int J Med Microbiol. 2009, 299 (5), pp. 323-332.
  11. Hashem Y. A., Yassin A. S., Amin M. A. Molecular characterization of Enterococcus spp. clinical isolates from Cairo, Egypt. Indian J Med Microbiol. 2015, 33, pp. 80-86.
  12. Jolley K. A., Bray J.E., Maiden M. C. J. Open-access bacterial population genomics: BIGSdb software, the PubMLST.org website and their applications. Wellcome Open Res. 2018, 3, pp. 124.
  13. Kawalec M., Pietras Z., Danilowicz E., et al. Clonal structure of Enterococcus faecalis isolated from Polish hospitals: characterization of epidemic clones. J Clin Microbiol. 2007, 45 (1), pp. 147-153.
  14. Kuch A., Willems R. J., Werner G., et al. Insight into antimicrobial susceptibility and population structure of contemporary human Enterococcus faecalis isolates from Europe. J Antimicrob Chemother. 2012, 67 (3), pp. 551-558.
  15. Mato R., Almeida F., Pires R., Rodrigues P., Ferreira T., Santos-Sanches I. Assessment of high-level gentamicin and glycopeptide-resistant Enterococcus faecalis and E. faecium clonal structure in a Portuguese hospital over a 3-year period. Eur J Clin Microbiol Infect Dis. 2009, 28 (7), pp. 855-859.
  16. Nayak M. Enterococcus faecalis: An Enigma in Root Canal Infections. International Research Journal of Pharmaceutical and Biosciences. 2016, 3 (1), pp. 12-21
  17. Padilla E. C., Nunez A. M., Padilla G. A., Lobos G. O. Genes de virulencia y bacteriocinas en cepas de Enterococcus faecalis aisladas desde diferentes muestras clinicas en la Region del Maule, Chile [Virulence genes and bacteriocins in Enterococcus faecalis strains isolated from different clinical samples in Maule Region, Chile]. Rev Chilena Infectol. 2012, 29 (1), pp. 55-61.
  18. Paganelli F. L., Willems R. J., Leavis H. L. Optimizing future treatment of enterococcal infections: attacking the biofilm? Trends Microbiol. 2012, 20 (1), pp. 40-49.
  19. Ruiz-Garbajosa P., Marc J. M., Bonten D. et al. Multilocus Sequence Typing Scheme for Enterococcus faecalis Reveals Hospital-Adapted Genetic Complexes in a Background of High Rates of Recombination. Journal of Clinical Microbiology. 2006, 44 (6), pp. 2220-2228.
  20. Schell C. M., Tedim A. P., Rodriguez-Banos M., et al. Detection of ß-Lactamase-Producing Enterococcus faecalis and Vancomycin-Resistant Enterococcus faecium Isolates in Human Invasive Infections in the Public Hospital of Tandil, Argentina. Pathogens. 2020, 9 (2), pp. 1-11.
  21. Seno Y., Kariyama R., Mitsuhata R., Monden K., Kumon H. Clinical implications of biofilm formation by Enterococcus faecalis in the urinary tract. Acta Med Okayama. 2005, 59 (3), pp. 79-87.
  22. Soares R. O., Fedi A. C., Reiter K. C., et al. Correlation between biofilm formation and gelE, esp, and agg genes in Enterococcus spp. Clinical isolates. Virulence. 2014, 1 (5), pp. 634-637.
  23. Solheim M., Aakra A., Snipen L. G., Brede D. A., Nes I. F. Comparative genomics of Enterococcus faecalis from healthy Norwegian infants. BMC Genomics. 2009, 10, [[. 1-11
  24. Song X., Sun J., Mikalsen T., Roberts A. P., Sundsfjord A. Characterisation of the plasmidome within Enterococcus faecalis isolated from marginal periodontitis patients in Norway. PLoS One. 2013, 8 (4), pp. 1-7.
  25. Todokoro D., Eguchi H., Suzuki T., et al. Genetic diversity and persistent colonization of Enterococcus faecalis on ocular surfaces. Jpn J Ophthalmol. 2018, 62 (6), pp. 699-705.
  26. Udo E. E., Al-Sweih N. Frequency of virulence-associated genes in Enterococccus faecalis isolated in Kuwait hospitals. Med Princ Pract. 201 1, 20 (3), pp. 259-264.
  27. Van Tyne D., Gilmore M. S. Friend turned foe: evolution of enterococcal virulence and antibiotic resistance. Annu Rev Microbiol. 2014, 68, pp. 337-356.
  28. Weng P. L., Ramli R., Shamsudin M. N., Cheah Y. K., Hamat R. A. High genetic diversity of Enterococcus faecium and Enterococcus faecalis clinical isolates by pulsed-field gel electrophoresis and multilocus sequence typing from a hospital in Malaysia. Biomed Res Int. 2013, pp. 1-6.
  29. Zheng J. X., Bai B., Lin Z. W., et al. Characterization of biofilm formation by Enterococcus faecalis isolates derived from urinary tract infections in China. J Med Microbiol. 2018, 67 (1), pp. 60-67.
  30. Zischka M., Künne C. T., Blom J., et al. Comprehensive molecular, genomic and phenotypic analysis of a major clone of Enterococcus faecalis MLST ST40. BMC Genomics. 2015, 16 (175), pp. 1-20

Copyright (c) 2021 Komenkova T.S., Zaitseva E.A., Shadrin A.M.

Creative Commons License
This work is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License.

This website uses cookies

You consent to our cookies if you continue to use our website.

About Cookies