MOLECULAR-GENETIC CRITERIA OF HIGH NEUROPHYSIOLOGICAL RESISTANCE OF FIREFIGHTERS TO ADVERSE OCCUPATIONAL FACTORS



Cite item

Abstract

Introduction. Firefighters' performance of their occupational duties is associated with significant psycho-emotional stress, as well as the complex influence of harmful and dangerous factors that are a source of risk to their health and life. One of the most important modern tasks of vocational training of employees in the EMERCOM of Russia is the problem of assessing psychophysiological reserves. Сurrently, traditional methods of psychological and psychophysiological testing do not allow a full assessment of psychophysiological reserves, because the degree of adaptation to extreme loads is determined by hereditary traits.

Objective: based on the analysis of neurodynamic and cognitive functions, to determine the genotypes of genes responsible for monoamine regulation of the brain, associated with high adaptive capabilities to long-term exposure to harmful factors of occupational activity of firefighters.

Methods: As part of the work, 453 people were examined, of which 234 people were the main group (firefighters), and 219 people were the control group. Testing was carried out using the following methods: "Correction test with Landolt rings", "Münsterberg test" and "Schulte tables", "Reaction to a moving object", "Simple visual-motor reaction" and KR-3-85 test batteries. Genotyping was performed using 5 candidate genes 5-HTTLPR or 5HTT, 5HT2A, COMT, DRD1, DRD2 / ANKK1.

Results: Analysis of the results of the study of indicators of attention, neurodynamic properties of the central nervous system and cognitive mental processes in the comparison groups, depending on the nature of the occupational tasks performed and employment duration, indicates the strain of the functional systems of the body during long-term work (more than 5 years) in the main study group ( firefighters). Firefighters carrying 5HTT L / L, 5HT2A C / C, COMT Val / Val, DRD2 / ANKK1 Glu / Glu genotypes, according to the results of most of the methods used, have statistically significantly higher rates than firefighters, carriers of 5HTT S / S, 5HT2A T / genotypes T, COMT Met / Met, DRD2 / ANKK1 Lis / Lis and at the same time lower indicators compared to individuals with similar genotypes from the control group.

Conclusion: The conducted studies have shown that there are no changes in the level of attention and neurodynamic properties of the central nervous system depending on the polymorphic variants of the DRD1 gene, and the indicators of cognitive mental processes in the control and main groups differ depending on the polymorphic variants of the COMT gene. The findings indicate the expediency of practical application of studies of the 5HTT, 5HT2A, and DRD2 / ANKK1 genes. The use of molecular genetic criteria will allow to make timely management decisions to preserve the health and professional longevity of firefighters, as well as to increase the efficiency of using robotic equipment in fire extinguishing, which will help to reduce material damage, sanitary and irreparable losses during emergency response.

Full Text

Введение

Выполнение пожарными своих профессиональных обязанностей связано со значительным психоэмоциональным напряжением, а также комплексным влиянием вредных и опасных факторов, являющихся источником риска для их здоровья и жизни [1, 10, 22]. Под психоэмоциональным напряжением следует понимать пограничное состояние, формирующееся в результате чрезмерного эмоционального напряжения и характеризующееся временным понижением устойчивости психических и психомоторных функций, выраженных соматовегетативными реакциями и снижением профессиональной работоспособности при невозможности полноценной эмоциональной разрядки и отключения от тревожно-депрессивных переживаний [11]. Кроме того, трудовая деятельность пожарных характеризуется психотравмирующими факторами, наиболее характерными и часто встречающимися из которых являются высокая температура окружающей среды, высокая плотность дыма, новизна раздражителей, воздействие шума, действие ограниченного пространства, опасность отравления химическими веществами, эмоционально-психологическое давление пострадавших людей [4, 13]. Согласно Методическим рекомендациям «Методы оценки и повышения функциональных резервов организма у специалистов МЧС России» первым этапом негативного воздействия стресс-факторов на организм пожарных являются психосоматические нарушения, которые вызывают ухудшение общего состояния здоровья, снижение работоспособности, качества жизни, что в конечном итоге может обуславливать повышение уровня заболеваемости, возникновение психосоматической патологии и снижения профессионального долголетия. Со стороны когнитивных функций на фоне нервно-эмоционального напряжения развиваются определенные нарушения, характеризующиеся изменениями памяти и внимания. При этом уменьшается объем долговременной и кратковременной памяти, снижается концентрация, ухудшается оперативная память и внимание. Нервно-эмоциональная напряженность ослабляет сознательный контроль и может привести к панике, быстро распространяющейся в условиях экстремальной обстановки с переходом к массовой психической реакции [25]. Именно поэтому одной из важнейших современных задач профессиональной подготовки сотрудников в системе МЧС России является проблема оценки психофизиологических резервов, под которыми понимают скрытые возможности организма переносить повышенную функциональную нагрузку, связанную с изменениями окружающей среды и гомеостаза [6, 24].

В зарубежной литературе данные о риске стрессовых расстройств у пожарных весьма противоречивы. С одной стороны, существуют данные о более высоком риске травматических стрессовых расстройств у пожарных относительно других категорий государственных служащих [27], а с другой – более низкий уровень тревожности, депрессии, эмоциональной нестабильности и отрицательных эмоций у пожарных по отношению к городским полицейским и служащим, что объясняется профессиональным отбором для работ в чрезвычайных ситуациях [30].

Кроме того, в настоящее время в МЧС России для пожаротушения и спасательных операций широко используются наземные, подводные робототехнические средства (РТС), включающие как зарубежные РТС так и образцы отечественного производства [18]. В соответствие с Концепцией развития робототехнических комплексов (систем) специального назначения в системе МЧС России до 2030 года современное развитие спасательной робототехники направлено на снижение риска для жизни и здоровья личного состава ФПС ГПС без ущерба эффективности проведения противопожарных, аварийно-спасательных и восстановительных работ. Широкое освоение и внедрение новых робототехнических технологий, требует от личного состава сохранения высоких кондиций нейродинамических и когнитивных функций [12, 14, 16, 19, 20].

Профессиональный отбор состоит из нескольких последовательных этапов, одним из которых является психологический отбор, научную основу исследований которого составляют вопросы индивидуальных различий, соотношения врожденных и приобретенных качеств, свойств личности, формирующих профессиональные способности, свойств нервной системы, а также проблемы надежности и валидности тестов. В зарубежной практике для обеспечения высокого качества тестов используются две основные процедуры: рецензирование и сертификация тестов [29]. Также обеспечиваются компетентность при использовании тестов, эффективность и безопасность тестирования [26]. Широко распространена и индивидуальная психологическая оценка (IPA), включающая стандартизованные тесты и собеседования, что позволяет оценивать более широкий спектр информации о кандидате [28].

В настоящее время традиционные методы психологического и психофизиологического тестирования с применением разнородных по характеру и структуре методик и их модификаций, прошедших проверку надежности, валидности и репрезентативности, не позволяют в полной мере провести оценку психофизиологических резервов, так как степень адаптации к экстремальным нагрузкам детерминирована наследственными признаками [5, 7]. Несоответствие предъявляемых требований и функциональных резервов организма может приводить к истощению адаптационных и компенсаторных механизмов организма и развитию явлений дезадаптации [17]. В этом ключе перспективным методом анализа является определение генетической детерминированности физических качеств и нейродинамических свойств нервной системы [2]. Использование молекулярно-генетических методов предоставит возможность дифференцировки личного состава по специфике функциональной нагрузки и будет способствовать более эффективному выполнению поставленных задач, сохранению здоровья и увеличению профессионального долголетия специалистов экстремальных видов деятельности, в том числе сотрудников МЧС России.

Материалы и методы.

В рамках проведения научно-исследовательской работы было обследовано 453 человека, из них 234 человека - оперативно-тактические сотрудники ФПС МЧС России, занимающиеся непосредственно пожаротушением, и 219 человек - контрольная группа, включающая сотрудников ФПС МЧС России, не участвующих в пожаротушении, в том числе 116 сотрудников надзорного звена. Возраст обследуемых составил в основной группе 34,5 ± 7,6 года, в контрольной группе - 31,3 ± 8,4 года.

Изучение внимания проводилось с применением методик «Корректурная проба с кольцами Ландольта», «Тест Мюнстерберга» и «Таблицы Шульте» (по методу А.Ю. Козыревой). В корректурной пробе с кольцами Ландольта, к которой не наступает привыкания, и на результат которой не оказывает влияние упражняемость [3], оценивали скорость переработки зрительной информации (Q, бит/с), которая является показателем продуктивности и устойчивости внимания и рассчитывается по формуле: Q = V – 2,807 × (P + O) / t, где t – время выполнения задания (с), Р – количество пропущенных знаков, О – количество ошибочно или неправильно зачеркнутых знаков, V – объем зрительной информации (бит) за время t (с); потеря информации, приходящейся на один пропущенный знак, приравнивалась к 2,807 бита. С помощью методики Мюнстерберга оценивали избирательность внимания, с помощью методики «Таблицы Шульте» определяли устойчивость внимания и динамику работоспособности. Для интерпретации результатов методики «Таблицы Шульте» по методу А.Ю. Козыревой рассчитывали эффективность работы (ЭР) и психическую устойчивость (выносливость) (ПУ) по формулам: ЭР = (Т1 + Т2 + Т3 + Т4 + Т5) / 5, где Тi – время работы с i-той таблицей, с; ПУ = Т4 / ЭР [8].

Методики «Реакция на движущийся объект» (РДО) и «Простая зрительно-моторная реакция» (ПЗМР), позволяющие оценить нейродинамические показатели сенсомоторного реагирования [15], проводили с помощью аппаратно-программного комплекса «НС-ПсихоТест» фирмы «Нейрософт». Методика РДО позволяет определить точность реагирования на раздражитель и судить об уравновешенности процессов возбуждения и торможения в коре головного мозга, применяется для оценки способности ориентации в пространстве и во времени, а также предвидения хода событий [21, 23]. Время сенсомоторных реакций отражает динамику скорости нервных процессов и их переключения, моторную координацию и активность нервной системы [9].

Оценку психических познавательных процессов проводили с помощью батареи тестов КР-3-85 (тесты структуры интеллекта), состоящей из 7 субтестов:

- в тестовом задании «Аналогии», сущность которого состоит в установлении логических отношений между понятиями по заданному образцу, исследуется функция вербального логического (понятийного) мышления;

- в тестовом задании «Числовые ряды», сущность которого состоит в установлении закономерностей, лежащих в основе построения числовых рядов, исследуется логичность мышления;

- в тестовом задании «Зрительная память» («Фигуры»), сущность которого состоит в запоминании геометрических фигур, а затем в воспроизведении показанных фигур на регистрационном листе по памяти, оценивается кратковременная зрительная память;

- в тестовом задании «Образное мышление» («Узоры»), который используется для исследования способности к образным представлениям, исследуется функция пространственно-образного мышления;

- в тестовом задании «Арифметический счет», сущность которого состоит в устном выполнении арифметических действий с целыми числами (в пределах 100), исследуются качества оперативной и кратковременной памяти, внимания, мышления (способности к преобразованию цифровой информации) и темповые характеристики психических процессов;

- в тестовом задании «Вербальная (словесная) память», сущность которого состоит в запоминании слов, оценивается кратковременная зрительная память;

- в тестовом задании «Установление закономерностей», сущность которого состоит в поиске слов с заданным порядком и количеством букв, исследуются функции логического мышления, памяти и внимания.

Генотипирование проводили по 5 кандидатным генам:

- ген 5-HTTLPR или 5HTT (serotonin-transporter-linked polymorphic region) – является полиморфным участком в гене SLC6A4, кодирующего белок-переносчик серотонина;

- ген 5HT2A (5-hydroxytryptamine (serotonin) receptor 2A) кодирует один из рецепторов серотонина, который играет важную роль в контроле аппетита, терморегуляции и сна и принимает участие в деятельности сердечно-сосудистой системы и мышечном сокращении;

- ген COMT (catechol-O-methyltransferase) кодирует катехол-о-метил-трансферазу – цитоплазматический фермент, являющийся ключевым модулятором моноаминовой системы голового мозга;

- ген DRD1 кодирует белок подтип D1 дофаминового рецептора, который стимулирует аденилатциклазу и киназы цАМФ;

- ген DRD2 располагается в регуляторной зоне гена, кодирует и регулирует экспрессию дофаминового рецептора второго типа (Д2-рецептор), который принимает участие в регуляции процессов синтеза и высвобождения дофамина во внеклеточное пространство ANKK1 (dopamine D2 receptor TaqIA C > T polymorphism), определяет плотность рецепторов дофамина второго типа в синаптической щели.

Основной метод исследования – полимеразно-цепная реакция (ПЦР). Оценку частоты аллелей проводили с помощью анализа полиморфизма длин рестрикционных фрагментов. Для выявления рестрикционных полиморфизмов проводилась обработка продуктов ПЦР рестриктазами производства фирмы New England Biolabs (Великобритания) в соответствии с инструкцией. Структура праймеров, использованных в исследовании, и рестриктазы, использованные для выявления рестрикционных полиморфизмов, представлены в таблице 1.

 

Материалы, полученные в ходе исследования, подвергались статистической обработке по стандартным программам для персональных ЭВМ («Excel», «Statistica-6»).

Отдельные группы предварительно сравнивали с помощью непараметрического теста Крускала – Уоллиса, а затем значимость различий уточняли с помощью теста Манна-Уитни.

Для математико-статистической обработки исходных данных, использовался следующий комплекс статистических процедур:

– для оценки вида распределения рассчитывались коэффициенты асимметрии и эксцесса в стандартизованном виде; в случае, если они были по абсолютной величине больше 2, то распределение оценивалось как нормальное и использовались параметрические методы оценки данных, в ином случае применялись непараметрические методы;

– расчет параметров вариации признаков (среднее арифметическое значение (x), стандартное отклонение (Sx), средняя квадратическая ошибка среднего значения (mx), 95%-доверительный интервал истинного значения); оценка значимости различий показателей в анализируемых выборках (по t-критерию Стьюдента).

Исследования проводились с соблюдением процедуры информированного согласия.

Результаты

Полученные результаты психологического и психофизиологического тестирования пожарных с различным стажем работы в сравнении с группой контроля представлены в таблице 2.

 

Основной задачей второго этапа исследования являлось определение генетических признаков поддержания высоких кондиций когнитивных функций и нейродинамических свойств центральной нервной системы на фоне профессиональных нагрузок при пожаротушении.

Распространенность генотипов рассматриваемых пяти кандидатных генов в группах сравнения представлена в таблице 3.

 

Полученные результаты исследований полиморфных вариантов генов регуляторов моноаминовой системы головного мозга в группах сравнения по отдельным показателям применяемых методик представлены в таблицах 4 и 5. 

 

Далее обследуемых разделили на 2 подгруппы. Первую подгруппу из 106 человек (из них 54 пожарных и 52 человека контрольной группы) составили носители генотипов 5HTT L/L, 5HT2A C/C, COMT Val/Val, DRD1 T/T, DRD2/ANKK1 Glu/Glu, которые ассоциированы с высокой подвижностью нервных процессов. Вторую подгруппу из 117 человек (из них 60 пожарных и 57 лиц контрольной группы) составили носители генотипов 5HTT S/S, 5HT2A T/Т, COMT Met/Met, DRD1 C/С, DRD2/ANKK1 Lys/Lys, ассоциированных с более низкой подвижностью нервных процессов. В данных подгруппах были проанализированы отдельные показатели по методикам оценки внимания (корректурная проба Ландольта), нейродинамических свойств центральной нервной системы (РДО) и познавательных психических процессов (КР 3-85 «Числовые ряды» и «Арифметический счет») (табл. 6).

 

Обсуждение

Результаты исследования, представленные в таблице 2 показали, что пожарные, выполняющие профессиональные задачи по пожаротушению, при стаже работы более 5 лет демонстрировали статистически значимо более низкие показатели внимания по интерпретации всех используемых методик относительно основной группы со стажем работы до одного года. В отношении аналогичной по стажу группы контроля отмечались статистически значимо более низкие показатели только по результатам методики Мюнстерберга и корректурной пробы с кольцами Ландольта.

Результаты сравнительной оценки нейродинамических свойств центральной нервной системы свидетельствуют, что у пожарных со стажем работы более 5 лет статистически значимо более низкие показатели реакции на движущийся объект и более высокие показатели латентных периодов простой зрительно-моторной реакции как в отношении аналогичной по стажу контрольной группы, так и относительно основной группы со стажем работы до одного года.  

Показатели методик «Аналогии», «Числовые ряды», «Зрительная память», «Арифметический счет» и «Установление закономерностей» в основной группе со стажем более 5 лет определялись статистически значимо более низкими как в отношении аналогичной по стажу группы контроля, так и относительно основной группы со стажем работы до одного года.

Таким образом, анализ результатов первого этапа исследования, представленных в таблице 2, свидетельствует о напряжении функциональных систем организма при длительной работе по специальности, что проявляется снижением функций познавательных психических процессов, нейродинамических свойств центральной нервной системы, объема, концентрации и устойчивости внимания.

Результаты анализа концентрации, объема и устойчивости внимания, представленные в таблице 4 (блок I), свидетельствуют о более высоких значениях показателей в группе с генотипом 5HTT L/L по интерпретации данных всех методик оценки внимания. При этом показатели концентрации, объема и устойчивости внимания по всем методикам были статистически значимо выше в группе контроля с аналогичным генотипом.

По интерпретации методик реакции на движущийся объект и простой зрительно-моторной реакции лучшая подвижность нервных процессов определялась в группах с генотипом 5HTT L/L, как в основной, так и в контрольной группе. В тоже время показатели нейродинамических свойств центральной нервной системы свидетельствуют о лучшей подвижности нервных процессов в контрольных группах относительно групп пожарных с аналогичными генотипами 5HTT. 

Стоит отметить, что по анализу показателей нейродинамических свойств центральной нервной системы группы с генотипом 5HTT S/L заняли промежуточное место.

Результаты анализа познавательных психических процессов свидетельствуют, что у пожарных, носителей генотипа 5HTT L/L, показатели батареи тестов были статистически значимо выше (за исключением показателей методик «Образное мышление» и «Вербальная память») относительно пожарных, носителей генотипа 5HTT S/S. Показатели методик «Арифметический счет», «Установление закономерностей» и «Числовые ряды» у пожарных были статистически значимо ниже, чем в контрольных группах с аналогичными генотипами.

Аналогичные тенденции в изменении показателей применяемых методик были отмечены при оценке результатов исследования в группах сравнения в зависимости от характера выполняемых профессиональных задач и генотипов гена DRD2/ ANKK1.

По интерпретации данных всех методик оценки внимания, результаты анализа свойств внимания свидетельствуют, что в группе с генотипом ANKK1 Glu/Glu показатели были статистически значимо более высокие, чем у носителей генотипа Lys/Lys. При этом оцениваемые показатели внимания по всем методикам были статистически значимо выше в группе контроля с аналогичным генотипом.

По интерпретации методик реакции на движущийся объект и простой зрительно-моторной реакции лучшая подвижность нервных процессов также определялась в группах с генотипом ANKK1 Glu/Glu как среди пожарных, так и среди лиц контрольной группы. Носители генотипа Glu/Lys демонстрировали промежуточные значения. В тоже время показатели нейродинамических свойств центральной нервной системы свидетельствуют о лучшей подвижности нервных процессов в контрольных группах относительно групп пожарных с аналогичными генотипами ANKK1.

Анализ данных, полученных с помощью батареи тестов КР 3-85 показал, что в обеих основных группах с генотипами ANKK1 Glu/Glu и Glu/Lys показатели по всем методикам были статистически значимо выше, чем в группе с генотипом ANKK1 Lys/Lys. Показатели методик «Аналогии», «Числовые ряды», «Арифметический счет» и «Установление закономерностей» в группах пожарных были статистически значимо ниже, чем у лиц контрольной группы с аналогичными генотипами.

            Представленные в таблице 4 (блок II) результаты анализа концентрации, объема и устойчивости внимания свидетельствуют о более высоких показателях в группе с генотипом 5HT2A C/C по интерпретации данных всех методик оценки внимания. При этом показатели концентрации, объема и устойчивости внимания по всем методикам были статистически значимо выше в группе контроля с аналогичными генотипами.

По интерпретации методик реакции на движущийся объект и простой зрительно-моторной реакции лучшая подвижность нервных процессов определялась в основных группах с генотипами C/C и C/Т 5HT2A. В тоже время показатели нейродинамических свойств центральной нервной системы свидетельствуют об отсутствии статистически значимых различий в подвижности нервных процессов в контрольных группах относительно групп пожарных с аналогичными генотипами гена 5HT2A.

Результаты анализа познавательных психических процессов свидетельствуют, что у пожарных носителей генотипа 5HT2A C/C показатели батареи тестов были статистически значимо выше (за исключением показателей методики «Образное мышление») относительно пожарных носителей генотипа 5HT2A T/T. Показатели методик «Аналогии», «Арифметический счет», «Установление закономерностей» и «Числовые ряды» у пожарных были статистически значимо ниже, чем в контрольных группах с аналогичными генотипами.

По интерпретации данных всех методик оценки внимания, представленных в таблице 5 (блок I), результаты анализа концентрации, объема и устойчивости внимания свидетельствуют, что в группах с генотипом COMT Val/Val показатели были статистически значимо более высокие, чем у носителей генотипа COMT Met/Met. При этом показатели концентрации, объема и устойчивости внимания по всем методикам были статистически значимо выше в группе контроля с аналогичным генотипом. Эти данные демонстрируют высокую степень стрессированности у пожарных, профессиональная деятельность которых связана с пожаротушением.

Анализ показателей нейродинамических свойств центральной нервной системы у пожарных основной группы в зависимости от полиморфных вариантов гена COMT в сравнении с лицами контрольной группы, профессиональная деятельность которых не связана с каждодневным стрессом, свидетельствует о некотором снижении подвижности нервных процессов. Статистически значимые различия получены только по количеству точных реакций в методике РДО и по скорости сенсомоторной реакции в методике ПЗМР. Также на снижение подвижности нервных процессов влияет носительство генотипа COMT Met/Met. По интерпретации методик реакции на движущийся объект и простой зрительно-моторной реакции лучшая подвижность нервных процессов статистически значимо определялась в группе контроля с генотипом COMT Val/Val, среди пожарных статистически значимые отличия определялись только по длительности опережающих и запаздывающих реакций в методике РДО и скорости сенсомоторной реакции в методике ПЗМР.

Анализ данных, представленных в таблице 5 (блок I), свидетельствует о ряде статистически значимых отличий по показателям методик оценки познавательных психических процессов у обследуемых с различными генотипами COMT. У пожарных показатели познавательных психических процессов были статистически значимо ниже или не имели статистически значимых различий относительно лиц с аналогичными генотипами из группы контроля. Среди пожарных в группах носителей генотипа COMT Met/Met определялись статистически значимо более низкие показатели относительно пожарных с генотипом COMT Val/Val (за исключением показателей методик «Зрительная память» и «Образное мышление»). В тоже время у лиц контрольной группы показатели познавательных психических процессов различались в зависимости от полиморфных вариантов гена COMT. Так, показатели методик «Установление закономерностей» и «Вербальная память» были статистически значимо выше у носителей гена COMT Met/Met. В тоже время показатели методик «Аналогии», «Числовые ряды» и «Арифметический счет» были статистически значимо выше у носителей генотипа COMT Val/Val.  

Результаты анализа оценки внимания, представленные в таблице 5 (блок II), свидетельствуют, что у пожарных показатели свойств внимания были статистически значимо ниже, чем у лиц контрольной группы с соответствующими генотипами. В тоже время изменений уровня внимания в зависимости от полиморфных вариантов гена DRD1 не наблюдается. 

Результаты анализа подвижности нервных процессов свидетельствуют, что у пожарных показатели реакции на движущийся объект и простой зрительно-моторной реакции статистически значимо ниже, чем у лиц контрольной группы с соответствующими генотипами. В тоже время изменений нейродинамических свойств центральной нервной системы в зависимости от полиморфных вариантов гена DRD1 не наблюдается.

Анализ познавательных психических процессов в зависимости от характера выполняемых профессиональных задач и полиморфных вариантов гена DRD1 свидетельствует о ряде статистически значимых отличий по показателям методик оценки познавательных психических процессов у обследуемых с различными генотипами гена DRD1. У пожарных показатели методик «Аналогии», «Числовые ряды», «Арифметический счет» были статистически значимо ниже относительно лиц с аналогичными генотипами из группы контроля. Среди пожарных в группах носителей генотипов DRD1 Т/Т и С/Т определялись статистически значимо более высокие показатели по всем методикам батареи тестов относительно пожарных с генотипом DRD1 С/С. Также у лиц контрольной группы показатели методик «Аналогии», «Зрительная память», «Образное мышление», «Вербальная память» и «Установление закономерностей» были статистически значимо выше у носителей генотипов DRD1 Т/Т и С/Т.

Результаты анализа отдельных показателей, представленные в таблице 6, свидетельствуют, что анализируемые показатели внимания, нейродинамических свойств центральной нервной системы и уровня логического математического мышления в  подгруппе 1 основной  группы с генотипами генов регуляторов моноаминовой системы головного мозга, ассоциированных с высокими адаптационными возможностями к долговременному воздействию вредных факторов профессиональной деятельности, были статистически значимо выше результатов, полученных во второй подгруппе основной группы, а также показывают отсутствие статистически значимых различий относительно лиц с аналогичными генотипами из группы контроля. В тоже время показатели оперативной и кратковременной памяти при исследовании функций логического мышления с помощью методики «Арифметический счет» в подгруппе 1 основной группы были статистически значимо ниже, чем в контрольной группе с аналогичными генотипами. Также необходимо отметить, что по всем проанализированным показателям в подгруппе 2 основной группы отмечены статистически значимые различия относительно носителей аналогичных генотипов контрольной группы.

Таким образом, результаты, полученные с помощью молекулярно-генетического анализа для носителей различных генотипов 5 кандидатных генов показывают, что:

- Пожарные, носители генотипов 5НТТ L/L, 5HT2A C/C, COMT Val/Val, DRD2/ANKK1 Glu/Glu отличаются статистически значимо более высокими показателями внимания, чем пожарные, носители генотипов 5НТТ S/S, 5HT2A T/T, COMT Met/Met, DRD2/ANKK1 Lis/Lis. При этом в группе контроля с аналогичным генотипом показатели внимания по всем методикам были статистически значимо выше. Необходимо отметить, что изменений уровня внимания в зависимости от полиморфных вариантов гена DRD1 не наблюдалось;

- По интерпретации методик РДО и ПЗМР лучшая подвижность нервных процессов определялась в основных группах носителей генотипов 5HTT L/L, DRD2/ANKK1 Glu/Glu, 5HT2A C/C и С/Т, по отдельным показателям – в основных группах носителей генотипов COMT Val/Val. Изменений нейродинамических свойств центральной нервной системы в зависимости от полиморфных вариантов гена DRD1 не наблюдалось. В тоже время показатели нейродинамических свойств центральной нервной системы свидетельствовали о лучшей подвижности нервных процессов в контрольных группах относительно групп пожарных с аналогичными генотипами генов 5HTT, DRD2/ANKK1, DRD1, по отдельным показателям – гена COMT. Необходимо отметить отсутствие статистически значимых различий в подвижности нервных процессов в контрольных группах относительно групп пожарных с аналогичными генотипами гена 5HT2A;

- Результаты анализа познавательных психических процессов свидетельствуют, что показатели батареи тестов были статистически значимо выше по большинству проанализированных методик у пожарных, носителей генотипов 5HTT L/L, 5HT2A C/C, DRD2/ANKK1 Glu/Glu и Glu/Lys, DRD1 T/T и С/Т, COMT Val/Val. Показатели отдельных методик у пожарных были статистически значимо ниже, чем в контрольной группе с аналогичными генотипами.

Выводы

  1. Проведенные исследования показали, что изменений уровня внимания и нейродинамических свойств центральной нервной системы в зависимости от полиморфных вариантов гена DRD1 не наблюдается, а показатели познавательных психических процессов у лиц контрольной и основной групп различаются в зависимости от полиморфных вариантов гена COMT;
  2. Полученные данные свидетельствуют о целесообразности практического применения исследований генов 5HTT, 5HT2A и DRD2/ANKK1;
  3. Применение молекулярно-генетических критериев позволит своевременно принимать управленческие решения по сохранению здоровья и профессионального долголетия пожарных, а также повысить эффективность использования в пожаротушении робототехнических средств, что будет способствовать снижению материального ущерба, санитарных и невосполнимых потерь при ликвидации чрезвычайных ситуаций.

 

 

Таблица 1

Праймеры и рестриктазы, использованные для выявления полиморфизмов исследуемых кандидатных генов

Полиморфизм

Праймер

Рестриктаза

Температура инкубирования, 0C

 

Val158Met (G472A) гена COMT

F: TCACCATCGAGATCAACCCC

R: ACAACGGGTCAGGCATGCA

Nla III

62

 
 

L/S гена 5HTT

F: CAATGTCTGGCGCTTCCCCTACATAT

R: GACATAATCTGTCTTCTGGCCTCTCAA

58

 
 

T102C гена 5HT2A

F: CAAGGTGAATGGTGAGCAGAAA

R: TGGCAAGTGACATCAGGAAATAGT

Msp I

58

 
 

A-48G 5'- нетранслируемая область гена DRD1

F: GGCTTTCTGGTGCCCAAGАСАGTG

R: AGCАСАGACСAGCGTGTTCCCCA

DrdI

63

 

C2137 гена DRD2

F: ССGTCGACCCTTCCTGAGTGTCATCA

R: CCGTCGACGGCTGGCCAAGTTGTCTA

Taq I

65

 

 

 

Таблица 2

Результаты исследования показателей внимания, нейродинамических свойств центральной нервной системы и познавательных психических процессов в группах сравнения в зависимости от характера выполняемых профессиональных задач и стажа работы по специальности, M±σ, n = 453

Тест/ Батарея тестов

Показатель/

Субтест

Основная группа

Контрольная группа

1 год

Более 5 лет

1 год

Более 5 лет

Исследование свойств внимания

Корректурная проба с кольцами Ландольта

Скорость переработки зрительной информации, Q, бит/с

1,64±0,12

1,34±0,16*#

1,58±0,14

1,52±0,13

Методика Мюнстерберга

Избирательность внимания, балл

21,2±1,7

18,1±0,8*#

20,7±2,1

19,3±1,2

Таблицы Шульте

Эффективность работы (ЭР), с

43,8±3,1

47,2±2,4#

45,2±2,3

46,8±1,7

Психическая устойчивость (ПУ)

0,7±0,1

0,9±0,2#

0,8±0,1

0,9±0,1

Исследование нейродинамических свойств центральной нервной системы

РДО

Количество точных реакций

14,5±1,4

11,8±1,8*#

14,1±1,3

13,7±1,5

Количество опережающих реакций

8,2±0,4

7,2±0,7*#

8,7±0,3

9,8±0,6

Количество запаздывающих реакций

8,1±0,3

11,4±1,4*#

8,1±0,9

7,1±0,4

Длительность опережающих реакций, мс

837,2±46,3

752,3±74,5*#

861,5±87,6

946,5±72,4

Длительность запаздывающих реакций, мс

819,3±39,1

1192,3±114,98*#

841,7±82,2

715,7±51,3

ПЗМР

Скорость сенсомоторной реакции, мс

217,5±9,2

251,4±11,4*#

216,7±8,5

218,3±9, 7

Исследование познавательных психических процессов

КР 3-85

Аналогии

27,2±1,4

23,7±1,6*#

26,9±1,2

27,4±1,5

Числовые ряды

25,9±0,9

22,5±2,2*#

24,8±1,4

24,1±1,9

Зрительная память

27,4±1,6

24,2±1,2*#

26,9±0,8

27,1±1,3

Образное мышление

25,9±1,3

27,9±1,2

25,3±1,6

23,5±1,6

Арифметический счет

23,8±1,6

16,9±1,2*#

24,1±1,8

23,3±1,5

Вербальная память

27,7±0,9

26,2±1,2

27,5±0,8

26,7±1,3

Установление закономерностей

28,2±1,4

23,5±1,7*#

27,9±1,6

27,1±1,5

*Различия относительно аналогичной по стажу контрольной группы, p < 0,05; #Различия относительно основной группы со стажем до 1 года, p < 0,05.

 

Таблица 3

Распространенность генотипов генов 5HTT, 5HT2A, COMT, DRD1 и DRD2 в группах сравнения

Группы

5HTT

5HT2A

COMT

DRD2

DRD1

S/S

L/S

L/L

C/C

C/T

T/T

Val/ Val

Val/Met

Met/ Met

Lys/Lys

Glu/Lys

Glu/Glu

C/C

C/T

T/T

Основная,

n=234

%

45

30

25

20

30

50

25

55

20

35

40

25

45

35

20

n

105

70

59

47

70

117

59

128

47

82

93

59

105

82

47

Контрольная,  

n=219

%

40

35

25

25

30

45

30

45

25

55

25

20

60

25

15

n

88

76

55

55

66

98

66

98

55

120

55

44

132

55

32

 

Таблица 4

Результаты исследования показателей внимания, нейродинамических свойств центральной нервной системы и познавательных психических процессов в группах сравнения в зависимости от характера выполняемых профессиональных задач и генотипов генов 5HTT, 5HT2A, DRD2/ANKK1, M±σ

I.                   Результаты исследования гена 5HTT, M±σ, n = 453

Тест/ Батарея тестов

Показатель/Субтест

Основная группа

Контрольная группа

S/S

L/S

L/L

S/S

L/S

L/L

Исследование свойств внимания

Корректурная проба с кольцами Ландольта

Скорость переработки зрительной информации, Q, бит/с

1,16

±0,14

1,32

±0,13

1,45

±0,171#

1,41

±0,16

1,53

±0,14

1,62

±0,21

Методика Мюнстерберга

Избирательность внимания, балл

16,3

±1,8

18,2

±1,2

22,4

±1,51#

17,3

±1,6

19,8

±1,4

24,5

±1,51

Таблицы Шульте

Эффективность работы (ЭР), с

48,1

±2,7

45,9

±1,6

42,6±

2,41#

41,3

±2,1

37,6

±2,8

35,3

±2,7

Исследование нейродинамических свойств центральной нервной системы

РДО

Количество точных реакций

8,4

±0,3

8,7

±0,31

13,8

±0,41#

11,4

±0,7

12,9

±0,51

15,2

±0,61

Количество опережающих реакций

8,4

±0,4#

7,3

±0,71#

7,9

±0,31#

9,1

±0,6

8,2

±0,41

8,2

±0,41

Количество запаздывающих реакций

16,2

±0,7#

15,6

±0,3#

11,7

±0,51#

10,2

±0,4

8,4

±0,71

8,3

±0,51

Длительность опережающих реакций, мс

752,6

±45,2#

748,4

±62,5#

712,4

±56,71#

923,7

±54,2

827,5

±47,2

824,9

±49,31

Длительность запаздывающих реакций, мс

1532,3

±51,4#

1483,6

±67,4#

1134,2

±48,91#

912,7

±46,5

841,7

±52,9

738,4

±45,6

ПЗМР

 

Скорость сенсомоторной реакции, мс

262,5

±9,3#

253,7

±7,5#

248,7

±7,21#

224,6

±9,7

219,5

±7,6

216,5

±8,61

Исследование познавательных психических процессов

КР 3-85

Числовые ряды

21,2

±1,2#

22,7

±1,3#

24,2

±1,41#

23,8

±0,9

25,2

±1,3

26,9

±2,51

Арифметический счет

16,4

±2,5#

16,8

±1,6#

18,3

±0,71#

21,4

±1,4

23,5

±2,2

24,7

±1,6

Установление закономерностей

21,8

±2,4#

23,3

±1,51#

23,8

±3,21#

25,2

±2,2

28,3

±3,1

28,7

±1,31

II.                Результаты исследования гена 5HT2A, M±σ, n = 453

Тест/ Батарея тестов

Показатель/Субтест

Основная группа

Контрольная группа

C/C

C/T

T/T

C/C

C/T

T/T

Исследование свойств внимания

Корректурная проба с кольцами Ландольта

Скорость переработки зрительной информации, Q, бит/с

1,42

±0,212#

1,33

±0,172#

1,21

±0,17#

1,59

±0,122

1,52

±0,192

1,39

±0,14

Методика Мюнстерберга

Избирательность внимания, балл

22,6

±1,82#

17,8

±0,92

15,9

±1,4

25,2

±1,62

18,9

±1,42

16,9

±1,7

Таблицы Шульте

Эффективность работы (ЭР), с

43,1

±1,82#

46,2

±1,5#

47,9

±2,1#

34,9

±2,22

38,1

±3,12

42,4

±2,5

Исследование нейродинамических свойств центральной нервной системы

РДО

Количество точных реакций

12,1

±0,52

10,5

±0,32

9,1

±0,4

15,1

±0,4

13,4

±0,5

10,9

±0,7

Количество опережающих реакций

7,2

±0,32

7,6

±0,82

8,2

±0,4

7,4

±0,5

8,7

±0,7

12,8

±0,4

Количество запаздывающих реакций

12,9

±0,32

13,2

±0,62

7,8

±0,8#

7,6

±0,4

8,2

±0,6

8,9

±0,7

Длительность опережающих реакций, мс

727,3

±51,52

751,3

±54,32

794,5

±62,2

757,4

±57,4

851,3

±64,2

1146,2

±71,3

Длительность запаздывающих реакций, мс

1037,4

±73,22

1362,7

±68,62

821,3

±71,4

779,3

±57,3

824,5

±74,6

897,6

±52,8

ПЗМР

Скорость сенсомоторной реакции, мс

247,5

±8,72

252,9

±9,22

254,3

±11,5

226,7

±9,7

221,8

±9,62

217, 9

±12,4

Исследование познавательных психических процессов 

КР 3-85

Аналогии

26,7

±1,52#

23,9

±1,22#

21,7

±1,4#

27,3

±1,52

26,1

±1,5

24,5

±1,4

Числовые ряды

24,2

±0,32#

22,6

±0,52#

21,5

±0,7#

27,4

±0,72

25,7

±0,3

24,2

±0,3

Арифметический счет

18,4

±0,52#

17,4

±0,4#

16,2

±0,7#

24,8

±0,52

22,3

±0,6

19,7

±0,3

Установление закономерностей

25,6

±0,22#

25,2

±0,42#

21,2

±0,5#

28,7

±0,42

27,3

±0,7

24,2

±0,5

1 Различия относительно носителей генотипа 5HTT S/S, p < 0,05; 2 Различия относительно носителей генотипа 5HT2A Т/Т, p < 0,05; # Различия относительно группы контроля с аналогичным генотипом, p < 0,05.

 

Таблица 5

Результаты исследования показателей внимания, нейродинамических свойств центральной нервной системы и познавательных психических процессов в группах сравнения в зависимости от характера выполняемых профессиональных задач и генотипов генов COMT, DRD1, M±σ

 

I.                   Результаты исследования гена COMT, M±σ, n = 453

Тест/ Батарея тестов

Показатель/

Субтест

Основная группа

Контрольная группа

Met/Met

Val/Met

Val/Val

Met/Met

Val/Met

Val/Val

Исследование свойств внимания

Корректурная проба с кольцами Ландольта

Скорость переработки зрительной информации, Q, бит/с

1,17

±0,16#

1,37

±0,211#

1,39

±0,281#

1,41

±0,21

1,54

±0,181

1,55

±0,191

Методика Мюнстерберга

Избирательность внимания, балл

15,3

±1,8

19,4

±1,31#

21,2

±0,91#

17,6

±1,5

23,2

±1,31

24,6

±1,71

Таблицы Шульте

Эффективность работы (ЭР), с

47,6

±1,5#

47,1

±1,4#

42,6

±1,81#

41,9

±2,3

41,2

±2,7

35,7

±1,81

Исследование нейродинамических свойств центральной нервной системы

РДО

Количество точных реакций

10,2

±0,3

10,8

±0,5

12,4

±0,7#

11,3

±0,7

14,2

±0,61

14,8

±0,41

Длительность опережающих реакций, мс

735,4

±62,7

715,7

±51,71

782,3

±56,31

878,5

±64,3

732,1

±61,4

712,2

±58,61

Длительность запаздывающих реакций, мс

1254,3

±53,2

1162,7

±61,41

1051,6

±59,71

1145,3

±64,7

932,6

±63,2

982,6

±52,51

ПЗМР

Скорость сенсомоторной реакции, мс

249,8

±14,5#

249,2

±12,3#

245,5

±9,81

231,7

±12,7

225,3

±11,6

221,4

±16,31

Исследование познавательных психических процессов

КР 3-85

Аналогии

22,8

±1,5

24,2

±1,4

24,5

±1,61

24,2

±1,2

25,8

±1,3

26,3

±1,51

Числовые ряды

22,5

±0,6

24,9

±0,4

25,3

±0,31

23,7

±0,6

26,1

±0,5

26,8

±0,31

Арифметический счет

15,3

±0,5#

18,6

±0,21#

19,4

±0,61#

17,2

±0,4

25,3

±0,61

26,4

±0,51

Вербальная память

22,3

±0,5#

25,8

±0,51

27,6

±0,71

29,1

±0,5

27,6

±0,3

26,7

±0,71

Установление закономерностей

23,7

±0,2#

25,2

±0,3

26,2

±0,31

27,8

±0,6

26,1

±0,7

25,8

±0,21

II.                Результаты исследования гена DRD1, M±σ, n = 453

Тест/ Батарея тестов

Показатель/Субтест

Основная группа

Контрольная группа

C/C

C/T

T/T

C/C

C/T

T/T

Исследование свойств внимания

Корректурная проба с кольцами Ландольта

Скорость переработки зрительной информации, Q, бит/с

1,28

±0,16#

1,32

±0,14#

1,33

±0,17#

1,49

±0,16

1,51

±0,12

1,52

±0,14

Методика Мюнстерберга

Избирательность внимания, балл

17,6

±1,7#

18,2

±1,5#

18,9

±0,4#

19,3

±1,3

21,1

±1,6

21,9

±1,4

Таблицы Шульте

Эффективность работы (ЭР), с

46,3

±1,3#

45,4

±1,7#

44,2

±1,42#

40,3

±2,6

39,7

±2,4

38,7

±1,5

Исследование нейродинамических свойств центральной нервной системы

РДО

Количество точных реакций

11,2

±0,3

11,4

±0,4#

11,7

±0,3#

12,5

±0,7

13,2

±0,5

14,2

±0,3

Количество опережающих реакций

7,9

±0,5#

8,2

±0,6#

8,6

±0,6#

7,3

±0,4

7,5

±0,3

7,1

±0,4

Длительность опережающих реакций, мс

794,6

±58,2

816,4

±56,5#

872,1

±59,4#

742,6

±61,7

761,4

±66,8

714,7

±51,2

ПЗМР

Скорость сенсомоторной реакции, мс

248,5

±13,7#

248,1

±12,4#

247,2

±11,3#

227,8

±12,7

227,4

±11,6

226,3

±14,3

Исследование познавательных психических процессов

КР 3-85

Аналогии

20,6

±0,3#

25,1

±0,42#

25,8

±0,22#

22,8

±1,4

27,2

±1,62

27,9

±1,82

Числовые ряды

23,2

±1,3#

24,3

±1,4#

24,8

±1,22#

25,9

±0,6

26,2

±0,7

26,4

±0,5

Зрительная память

21,4

±0,3

26,2

±0,52

27,7

±0,62

21,3

±0,3

28,4

±0,42

29,2

±0,52

Образное мышление

23,9

±0,5

29,3

±0,22

29,8

±0,32

23,1

±0,4

29,6

±0,32

29,2

±0,52

Арифметический счет

16,9

±0,4

17,2

±0,32#

17,6

±0,62#

21,8

±0,4

22,7

±0,6

23,1

±0,3

Вербальная память

21,4

±0,4

28,2

±0,32

28,6

±0,42

23,4

±0,5

28,9

±0,22

29,2

±0,72

Установление закономерностей

19,8

±0,8

27,9

±0,42

28,3

±0,52

21,2

±0,7

28,1

±0,32

29,1

±0,52

             

1 Различия относительно носителей генотипа COMT Met/Met, p < 0,05; 2 Различия относительно носителей генотипа DRD1 C/C, p < 0,05; # Различия относительно группы контроля с аналогичным генотипом, p < 0,05.

 

 

Таблица 6

Результаты исследования отдельных показателей по методикам оценки внимания, нейродинамических свойств ЦНС и познавательных психических процессов в зависимости от характера выполняемых профессиональных задач и генотипов генов, M±σ

Тест

Показатели

Основная группа

Контрольная группа

Подгруппа

2, n=60

Подгруппа 1, n=54

Подгруппа 2, n=57

Подгруппа 1, n=52

Корректурная проба с кольцами Ландольта

Скорость переработки зрительной информации, Q, бит/с

1,12

±0,13*

1,54

±0,12#

1,35

±0,14

1,57

±0,14#

 РДО

Количество точных реакций

8,6

±0,3*

14,2

±0,8#

12,1

±0,5

15,3

±0,7#

 

КР 3-85

Числовые ряды

20,4

±0,5*

25,4

±0,4#

23,72

±0,6

27,1

±0,4#

Арифметический счет

15,2

±0,6*

19,1

±0,5*#

17,8

±0,7

26,2

±0,6#

* Различия относительно носителей аналогичной подгруппы контрольной группы, p < 0,05; # Различия относительно подгруппы 2 аналогичной группы, p < 0,05.

 

 

 

×

About the authors

Vladimir E. Kriyt

ФБУН «СЗНЦ гигиены и общественного здоровья» Роспотребнадзора

Author for correspondence.
Email: vladimirkriit@list.ru
ORCID iD: 0000-0002-1530-4598
SPIN-code: 8249-9420
Scopus Author ID: 39361885200

кандидат химических наук, руководитель отдела комплексной гигиенической оценки физических факторов

Russian Federation, 191036, Россия, Санкт-Петербург, 2-я Советская ул., д. 4,

YUliya N. Sladkova

ФБУН «СЗНЦ гигиены и общественного здоровья» Роспотребнадзора

Email: Sladkova.julia@list.ru
ORCID iD: 0000-0003-1745-2663
SPIN-code: 1892-2912
Scopus Author ID: 55925196200
Russian Federation, 191036, Россия, Санкт-Петербург, 2-я Советская ул., д. 4

M. V. Sannikov

Nikiforov Russian Center of Emergency and Radiation Medicine, EMERCOM of Russia

Email: smakv@mail.ru
ORCID iD: 0000-0003-3969-9501
SPIN-code: 3663-4650
Scopus Author ID: 57209200086
Russian Federation, 194044, Россия, Санкт-Петербург, Академика Лебедева ул., 4/2

Andrey Borisovich Gudkov

Северный государственный медицинский университет

Email: gudkovab@nsmu.ru
ORCID iD: 0000-0001-5923-0941
SPIN-code: 4369-3372
Scopus Author ID: 34876731200

доктор медицинских наук, профессор, директор института гигиены и экологии

Russian Federation, 163000, г. Архангельск, пр. Троицкий, д. 51

Alexander O. Pyatibrat

St. Petersburg State Pediatric Medical University of the Ministry of Health of the Russian Federation

Email: a5brat@yandex.ru
ORCID iD: 0000-0001-6285-1132
SPIN-code: 9812-4780
Scopus Author ID: 57203367911

MD, PhD, Dr. Sci. (Med.), Associate Professor, Department of Mobilization Healthcare Training & Catastrophe Medicine

Russian Federation, Saint Petersburg

References

  1. Aleksanin S. S., Sannikov M. V, Astaf'ev O. M. Medicinskie posledstviya vliyaniya proizvodstvennyh faktorov na pozharnyh [Medical consequences of occupational factors influence for firefighters]. Vestnik Rossiyskoy voenno-meditsinskot akademii [Bulletin of the russian military medical academy]. 2008, 3 (2), р. 158-160. [In Russian]
  2. Bartash V. A. Puti povysheniya effektivnosti sistemy professional'nogo otbora sotrudnikov specpodrazdelenij silovyh struktur [Ways to improve the efficiency of the system of professional selection of employees of special forces of power structures]. Aktual'nye problemy fizicheskoj i special'noj podgotovki silovyh struktur [Actual problems of physical and special training of power structures]. 2012. 5 (18). pp. 18-21. [In Russian]
  3. Brunner Е. Y. Novye vozmozhnosti diagnostiki vnimaniya po korrekturnoj probe na osnove oftal'mologicheskih kolec E. Landol'ta [New opportunities for the attention diagnostics with the help of a proof-reading test based on e.landolt’s ophthalmological rings]. Problemy sovremennogo pedagogicheskogo obrazovaniya [Problems of modern pedagogical education]. 2015. 48 (1). pp. 364-372. [In Russian]
  4. Valitova N. E., Khairetdinov I. A. Vliyanie stress-faktorov na proizvoditel'nost' truda sotrudnikov podrazdelenij pozharnoj ohrany [The influence of stress factors on fire protection employees’ job performance]. Neftegazovoe delo [Petroleum engineering]. 2014, 12(1). pp. 168-171. [In Russian]
  5. Guseva I. V. Psihologicheskie determinanty uspeshnosti professional'noj deyatel'nosti pozharnyh MCHS [Psychological determinants of the success of the professional activity of firefighters of the Ministry of Emergency Situations]. European Social Science Journal. 2016. 8. pp. 237-239. [In Russian]
  6. Domrachev A. A., Melnik A. A., Michailova L. A. Soprovozhdenie professional'noj deyatel'nosti pozharnyh operativnyh podrazdelenij kak napravlenie obespecheniya effektivnosti funkcionirovaniya federal'noj protivopozharnoj sluzhby MCHS Rossii [Providing of professional activity of operational subdivisions as a method of providing efficiency at federal fire service of emercom of Russia]. Psihologo-pedagogicheskie problemy bezopasnosti cheloveka i obshchestva [Psychological and pedagogical safety problems of human and society]. 2009. 1 (2). pp. 49-54. [In Russian]
  7. Drannikov A. A., Mandryka V. S., Butenko Y. L. Metody korrektirovki psihologicheskogo sostoyaniya pozharnogo pri tushenii pozharov i likvidacii chrezvychajnyh situacij [Methods for adjusting the psychological state of a firefighter during fire-fighting and emergency response]. Pozharnaya i tekhnosfernaya bezopasnost': problemy i puti sovershenstvovaniya [Civil Defence Academy Journal]. 2020. 2 (6). pp. 136-139. [In Russian]
  8. D'yakonov I. F., Ovchinnikov B. V. Psihologicheskaya diagnostika v praktike vracha [Psychological diagnostics in the practice of a doctor]. SPb: SpecLit, 2008. 143 p. [In Russian]
  9. Ignatova Yu. P., Makarova I. I., Yakovleva K. N., Aksenova A.V. Zritel'no-motornye reakcii kak indikator funkcional'nogo sostoyaniya central'noj nervnoj sistemy [Visual-motor reactions as an indicator of cns functional state]. Ul'yanovskij mediko-biologicheskij zhurnal [Ulyanovsk Medico-biological Journal]. 2019. 3. pp. 38-51. doi: 10.34014/2227-1848-2019-3-38-51/ [In Russian]
  10. Karapetyan L. V. Psihologicheskie determinanty professional'noj uspeshnosti spasatelej MCHS Rossii [Psychological determinants of professional success of rescuers of emercom of Russia]. Mediko-biologicheskie i social'no-psihologicheskie problemy bezopasnosti v chrezvychajnyh situaciyah [Medicо-Biological and Socio-Psychological Problems of Safety in Emergency Situations]. 2019. 3. pp. 106-115. doi: 10.25016/2541-7487-2019-0-3-106-115 [In Russian]
  11. Kartavenko M. W., Chekina A. D. Opredelenie urovnej psihoemocional'noj napryazhennosti i stressa [Definition of levels psycoemotional of intensity and stress]. Izvestiya YUFU. Tekhnicheskie nauki [Izvestiya SFedU. Engineering sciences]. 2008, 6. pp. 80-83. [In Russian]
  12. Kondaurova O. P., Gorbunova YA. A. Osobennosti pokazatelej stressoustojchivosti [Features of stress resistance indicators among employees of the state fire service EMERCOM of Russia]. Tendencii razvitiya nauki i obrazovaniya [Trends in the development of science and education]. 2020. 62 (19). pp. 72-75. doi: 10.18411/lj-06-2020-446 [In Russian]
  13. Koshkarov V. S., Troshunin A. V. Vliyanie stress-faktorov na psihiku pozharnyh. Materialy I mezhdunarodnoj nauchnoj konferencii «Aktual'nye voprosy sovremennoj psihologii» [The influence of stress factors on the psyche of firefighters. Materials of the I International Scientific Conference "Topical Issues of Contemporary Psychology"]. Chelyabinsk, March 2011. pp. 53-55. [In Russian]
  14. Kulikova T. I. Vliyanie professional'nogo stressa na psihicheskoe zdorov'e specialistov pozharnoj sluzhby MCHS [The impact of occupational stress on the mental health of fire department specialists of the Ministry of Emergency Situations]. Nauchno-metodicheskij elektronnyj zhurnal koncept [The periodical scientific and methodological electronic journal "Koncept"]. 2017. 43. pp. 34-38. [In Russian]
  15. Larionova O. V., Dravitsa L. V. Nejrodinamicheskie pokazateli sensomotornogo reagirovaniya detej mladshego shkol'nogo vozrasta s ortoforiej i geterotropiej [Neurodynamic indicators of the sensorimotor response of primary school age children with orthophoria and heterotropia]. Problemy zdorov'ya i ekologii [Health and ecology issues]. 2020. 2(64). pp. 85-90. [In Russian]
  16. Paniotova D. U., Krasavin N. A. K voprosu ob osobennostyah stressa i stressoustojchivosti pozharnyh [To the issue of stress and stress resistance of firefighters]. Pozharnaya i tekhnosfernaya bezopasnost': problemy i puti sovershenstvovaniya [Civil Defence Academy Journal]. 2020. 2 (6). pp. 312-314. [In Russian]
  17. Rybnikov V. YU. Bobrishchev A. A., Golub YA. V. Audiovizual'naya korrekciya funkcional'nogo sostoyaniya sportsmenov: teoriya i praktika [Audiovisual correction of the functional state of athletes: theory and practice]. SPb: Polytechnic-service, 2009. 48 p. [In Russian]
  18. Severov N. V., Baikov, A. V., Noskov S. S. and etc. Osnovy spasatel'noj robototekhniki [Rescue Robotics Fundamentals]. Uchebnoe posobie, Himki: AGZ MCHS RF, 2017. P. 99. [In Russian]
  19. Timchuk I. A., Sokolov K. E. Stressovye sostoyaniya pozharnyh [Stress states of firemen]. Nauchnyj elektronnyj zhurnal Meridian [Scientific electronic journal Meridian]. 2019. 15 (33). pp. 495-497. [In Russian]
  20. Travnikova E. E. Uroven' adaptivnosti i nervno-psihicheskaya ustojchivost' u pozharnyh na primere sotrudnikov pozharnoj sluzhby FGKU «2 otryad FPS» (po Primorskomu krayu) [The level of adaptability and neuropsychic stability in firefighters by the example of the fire service employees of the FGKU "2nd detachment of the FPS" (across the Primorsky Territory)]. Molodoj uchenyj [Young Scientist]. 2016. 11 (115). pp. 1785-1790. [In Russian]
  21. Familnikova N. V., Polevschikov М. М., Rozhentsov V. V. Ocenka tochnosti reakcii cheloveka na dvizhushchijsya ob"ekt [Accuracy evaluation of a human's reaction to a moving object]. Sovremennye naukoemkie tekhnologii [Modern high technologies]. 2016. 2. pp. 176-179. [In Russian]
  22. Fufaeva I. G., Gudilina V. А. Analiz vliyaniya stressa na razvitie somatogennoj patologii u pozharnyh-spasatelej MCHS [Analysis of the stress effect on the development of somatogenic pathology in firemen-rescuers of emercom DPR]. Pozharnaya i tekhnosfernaya bezopasnost': problemy i puti sovershenstvovaniya [Civil Defence Academy Journal]. 2019, 1 (2), pp. 274-278. [In Russian]
  23. Khalfina R. R., Galin M. R., Minullin A. Z. Psihofiziologicheskie osobennosti sensomotornyh kachestv sotrudnikov, obespechivayushchih gosudarstvennuyu zashchitu [Physiological characteristics of sensorimotor skills of the employees providing state protection]. Uspekhi sovremennogo estestvoznaniya [Advances in current natural sciences]. 2014. 11. pp. 99-102. [In Russian]
  24. CHerkesov V. V., Ermak V. A. Professional'no-vazhnye kachestva pozharnyh-spasatelej MCHS [Professionally important qualities f fire and rescue workers of the ministry of emergency situations]. Vestnik gigieny i epidemiologii [Hygiene and Epidemiology Bulletin]. 2020. 24 (2). pp. 207-209. [In Russian]
  25. CHermyanin S. V., Reshetnikov M. M., Korzunin V. A. Dinamika processov adaptacii u voennosluzhashchih – uchastnikov boevyh dejstvij [The dynamics of adaptation processes among military personnel - participants in hostilities]. Materialy Vserossijskoj nauchno-prakticheskoj konferencii «Aktual'nye voprosy povysheniya rabotosposobnosti i vosstanovleniya zdorov'ya voennosluzhashchih i grazhdanskogo naseleniya v usloviyah chrezvychajnyh situacij» [Materials of the All-Russian Scientific and Practical Conference "Topical Issues of Increasing the Working Capacity and Recovering the Health of Servicemen and Civilians in Emergency Situations"]. SPb, VMedA, December 6-7, 2006. pp. 153-156. [In Russian]
  26. Bartram Dave. Standarty testov, kvalifikaciya i sertifikaciya pol'zovatelej testov [Test standards, qualifications and certification of test users]. Bulletin of the South Ural State University. Series “Psychology”, issue 12. 2011. № 5. С. 15-24.
  27. Han Minkyung, Park Sohee, Park Jong Heon, Hwang Seung-sik, Kim Inah. Do police officers and firefighrers have a higher risk of disease than other public officers? A 13-year nationwide cohort study in South // Occupational and environmental medicine research. 2018. N 8(1): e019987. doi: 10.1136/bmjopen-2017-019987.
  28. Ilianna H. Kwaske. Scott B Morris. The Validity of Individual Psychological Assessments for Entry-Level Police and Firefighter Positions // Personnel Assessment and Decisions. 2015. N 1(1): 18-29. doi: 10.25035/pad.2015.003.
  29. Lindley Patricia. Gosudarstvennye i mezhdunarodnye podhody k standartam kachestva v testirovanii: poziciya Velikobritanii [National and international approaches to quality standards in testing: the position of the UK]. Bulletin of the South Ural State University. Series “Psychology”, issue 13. 2011. № 18. С. 60-65.
  30. Tommasi Marco, Conte M Marco, Saggino Aristide. Stress, psychological disease, psychological well-being and personality in Italian firefighters compared to other working categories // Cogent Psychology. 2021. 8(1) :1-20. doi: 10.1080/23311908.2021.1912249.

Supplementary files

There are no supplementary files to display.


Copyright (c) Kriyt V., Sladkova Y., Sannikov M.V., Gudkov A.B., Pyatibrat A.O.

Creative Commons License
This work is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License.

This website uses cookies

You consent to our cookies if you continue to use our website.

About Cookies